ID: 1058211834_1058211840

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1058211834 1058211840
Species Human (GRCh38) Human (GRCh38)
Location 9:102178217-102178239 9:102178269-102178291
Sequence CCAAACAGCTCTCTCAGCTGTGC AGGTGTTGATGAGGGCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!