ID: 1058239796_1058239799

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1058239796 1058239799
Species Human (GRCh38) Human (GRCh38)
Location 9:102542463-102542485 9:102542502-102542524
Sequence CCTGACATCATCTGTAAATAACT ACAGCTCTTAGCTTGCTACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 460} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!