ID: 1058378689_1058378691

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1058378689 1058378691
Species Human (GRCh38) Human (GRCh38)
Location 9:104354992-104355014 9:104355042-104355064
Sequence CCCTAAAACTTAAAGTATAATAA TTCTCCTGCATTCCATCTCCAGG
Strand - +
Off-target summary {0: 13628, 1: 11495, 2: 6190, 3: 3554, 4: 2856} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!