ID: 1058850393_1058850399

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1058850393 1058850399
Species Human (GRCh38) Human (GRCh38)
Location 9:109006439-109006461 9:109006477-109006499
Sequence CCTACACTCTTAATCACTACACC CAGGATTATGTTAAGGATCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 45, 4: 247} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!