ID: 1058870041_1058870045

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1058870041 1058870045
Species Human (GRCh38) Human (GRCh38)
Location 9:109193432-109193454 9:109193472-109193494
Sequence CCATTTTTAAGAGGAAGAAATTG GGTTTTGGAAGTGAGTGCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!