ID: 1059043525_1059043531

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1059043525 1059043531
Species Human (GRCh38) Human (GRCh38)
Location 9:110840454-110840476 9:110840505-110840527
Sequence CCAAGAAATCAGTATGGGATTCC TATTTAGAAAATATTCTGTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 102} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!