ID: 1059107127_1059107134

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1059107127 1059107134
Species Human (GRCh38) Human (GRCh38)
Location 9:111521542-111521564 9:111521578-111521600
Sequence CCAGTCAGTTTCCAATCTACCAG GGCAAGCCCCTCCCTGCGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 27, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!