ID: 1059234830_1059234832

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1059234830 1059234832
Species Human (GRCh38) Human (GRCh38)
Location 9:112752065-112752087 9:112752088-112752110
Sequence CCTAGTAAAATACTAAATGAATT CCCCCTTGTCCCAATATTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 589} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!