ID: 1059271598_1059271602

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1059271598 1059271602
Species Human (GRCh38) Human (GRCh38)
Location 9:113072932-113072954 9:113072981-113073003
Sequence CCTGGTGTGCACCTGCGTGTGTG TGTGCGCGCGCGCGCGTGCTGGG
Strand - +
Off-target summary No data {0: 6, 1: 3, 2: 20, 3: 64, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!