ID: 1059305045_1059305058

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1059305045 1059305058
Species Human (GRCh38) Human (GRCh38)
Location 9:113347424-113347446 9:113347472-113347494
Sequence CCATGGCCTATTTCCCTCCCCAC TGAGGCCATCACCCTCCCACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 25, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!