ID: 1059650687_1059650696 |
View in Genome Browser |
Spacer: 7 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1059650687 | 1059650696 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 9:116313294-116313316 | 9:116313324-116313346 |
Sequence | CCCACCCCAGAATCCTTTTCCAA | TCATATGTGCAGGTGGTGAAAGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 0, 2: 1, 3: 31, 4: 306} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |