ID: 1059650692_1059650696

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1059650692 1059650696
Species Human (GRCh38) Human (GRCh38)
Location 9:116313307-116313329 9:116313324-116313346
Sequence CCTTTTCCAAACATGACTCATAT TCATATGTGCAGGTGGTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 253} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!