ID: 1059697744_1059697748

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1059697744 1059697748
Species Human (GRCh38) Human (GRCh38)
Location 9:116744841-116744863 9:116744880-116744902
Sequence CCTCTGCTAGCTGTCAGTCCACC CTGTGAGACCCACAGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!