ID: 1059711451_1059711457

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1059711451 1059711457
Species Human (GRCh38) Human (GRCh38)
Location 9:116871445-116871467 9:116871472-116871494
Sequence CCTCTATCATAAGTCCCTGCCTA CTCCCAATGACCCTTGTGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!