ID: 1059792947_1059792955

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1059792947 1059792955
Species Human (GRCh38) Human (GRCh38)
Location 9:117660410-117660432 9:117660458-117660480
Sequence CCATGCTGCCTCTGTGGAGGCAG GGGCCGGAAGATTCACCAAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 58, 4: 396} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!