ID: 1059943467_1059943470

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1059943467 1059943470
Species Human (GRCh38) Human (GRCh38)
Location 9:119381151-119381173 9:119381171-119381193
Sequence CCCTCAGCAACATCTTAAACCAG CAGTATCTTCATCTTCAACATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!