ID: 1060113328_1060113330

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1060113328 1060113330
Species Human (GRCh38) Human (GRCh38)
Location 9:120921995-120922017 9:120922022-120922044
Sequence CCTGGGAATTGCTGCTAGCCAAG GAATTATGCAGAACCACCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 164} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!