ID: 1060120732_1060120740

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1060120732 1060120740
Species Human (GRCh38) Human (GRCh38)
Location 9:120987193-120987215 9:120987239-120987261
Sequence CCTAACTTCTTAGGAAAGAAGTT GGCCATTGGCCTAGATGTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!