ID: 1060125601_1060125608

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1060125601 1060125608
Species Human (GRCh38) Human (GRCh38)
Location 9:121041621-121041643 9:121041668-121041690
Sequence CCGAGGAAGGTCCCAGCCTCTGG GACTGATGACCCTTAGTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 42, 4: 353} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!