ID: 1060168769_1060168772

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1060168769 1060168772
Species Human (GRCh38) Human (GRCh38)
Location 9:121443286-121443308 9:121443333-121443355
Sequence CCATGCACAATGTAAAGATAAGA AAACAGGGTCTCTGTTGCCCAGG
Strand - +
Off-target summary No data {0: 8, 1: 152, 2: 636, 3: 1384, 4: 2384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!