ID: 1060168769_1060168773

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1060168769 1060168773
Species Human (GRCh38) Human (GRCh38)
Location 9:121443286-121443308 9:121443337-121443359
Sequence CCATGCACAATGTAAAGATAAGA AGGGTCTCTGTTGCCCAGGCTGG
Strand - +
Off-target summary No data {0: 140, 1: 573, 2: 1676, 3: 3997, 4: 14283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!