ID: 1060187936_1060187940

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1060187936 1060187940
Species Human (GRCh38) Human (GRCh38)
Location 9:121575213-121575235 9:121575241-121575263
Sequence CCCAGGCCTGGGCTTCTATCTGC CTCCGTGTGACCTGTGAGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!