ID: 1060431395_1060431403

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1060431395 1060431403
Species Human (GRCh38) Human (GRCh38)
Location 9:123553988-123554010 9:123554033-123554055
Sequence CCTTGTGATCCACCTCTCTCGGC GGCGTGAGCCAATGAAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 72, 2: 1925, 3: 13051, 4: 40115} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!