ID: 1060431396_1060431403

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1060431396 1060431403
Species Human (GRCh38) Human (GRCh38)
Location 9:123553997-123554019 9:123554033-123554055
Sequence CCACCTCTCTCGGCTTCCCAAAG GGCGTGAGCCAATGAAGAGCAGG
Strand - +
Off-target summary {0: 4, 1: 99, 2: 3197, 3: 46694, 4: 175507} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!