ID: 1060431397_1060431403

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1060431397 1060431403
Species Human (GRCh38) Human (GRCh38)
Location 9:123554000-123554022 9:123554033-123554055
Sequence CCTCTCTCGGCTTCCCAAAGTGC GGCGTGAGCCAATGAAGAGCAGG
Strand - +
Off-target summary {0: 11, 1: 440, 2: 13782, 3: 161594, 4: 299963} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!