ID: 1060514632_1060514644

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1060514632 1060514644
Species Human (GRCh38) Human (GRCh38)
Location 9:124258112-124258134 9:124258129-124258151
Sequence CCGGTGGGGCCCCGCGGCCCGGA CCCGGAGAAGGGCGGGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 161} {0: 1, 1: 0, 2: 9, 3: 49, 4: 528}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!