ID: 1060610538_1060610541

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1060610538 1060610541
Species Human (GRCh38) Human (GRCh38)
Location 9:124960349-124960371 9:124960371-124960393
Sequence CCTCCTGAAGTATTCAGATTACA AGACAGGAGCCACCATGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 84, 3: 1050, 4: 10575} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!