ID: 1060703181_1060703189

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1060703181 1060703189
Species Human (GRCh38) Human (GRCh38)
Location 9:125777465-125777487 9:125777496-125777518
Sequence CCTGCCTCAGCCTCCCAAGTAGC CAGGTGCAAGCTGCCGTGCCTGG
Strand - +
Off-target summary {0: 74529, 1: 175606, 2: 216051, 3: 220891, 4: 278507} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!