ID: 1060737343_1060737348

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1060737343 1060737348
Species Human (GRCh38) Human (GRCh38)
Location 9:126074444-126074466 9:126074496-126074518
Sequence CCACTTTCATGTGCGTCCGTGTG CAATAAAGCTTTTAATCACCTGG
Strand - +
Off-target summary No data {0: 240, 1: 81, 2: 18, 3: 42, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!