ID: 1060816517_1060816532

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1060816517 1060816532
Species Human (GRCh38) Human (GRCh38)
Location 9:126638159-126638181 9:126638205-126638227
Sequence CCTGGCCCAGGTGAGCCCCTCTC TCCCGACAGGAATGCTCCGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!