ID: 1060834557_1060834562

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1060834557 1060834562
Species Human (GRCh38) Human (GRCh38)
Location 9:126745313-126745335 9:126745355-126745377
Sequence CCAGCCTGGGTGACAGAGTGAGA ATTAATACAGAGATGGAGCAAGG
Strand - +
Off-target summary {0: 30388, 1: 79844, 2: 153170, 3: 168549, 4: 152343} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!