ID: 1060834558_1060834562

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1060834558 1060834562
Species Human (GRCh38) Human (GRCh38)
Location 9:126745317-126745339 9:126745355-126745377
Sequence CCTGGGTGACAGAGTGAGATTCC ATTAATACAGAGATGGAGCAAGG
Strand - +
Off-target summary {0: 601, 1: 13816, 2: 51224, 3: 115031, 4: 145795} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!