ID: 1060878957_1060878963

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1060878957 1060878963
Species Human (GRCh38) Human (GRCh38)
Location 9:127104369-127104391 9:127104399-127104421
Sequence CCCAGAACCCAGGTGCCTGCTCT GCCTCTTAGAGAATGACCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 277} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!