ID: 1060878960_1060878963

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1060878960 1060878963
Species Human (GRCh38) Human (GRCh38)
Location 9:127104377-127104399 9:127104399-127104421
Sequence CCAGGTGCCTGCTCTATCCTTTG GCCTCTTAGAGAATGACCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 234} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!