ID: 1060906609_1060906620

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1060906609 1060906620
Species Human (GRCh38) Human (GRCh38)
Location 9:127312959-127312981 9:127312993-127313015
Sequence CCCAGAGGCAGGGCAAGCCCCAG TCAGAGGCCCAGTAATGTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 418} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!