ID: 1060920202_1060920214

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1060920202 1060920214
Species Human (GRCh38) Human (GRCh38)
Location 9:127415045-127415067 9:127415081-127415103
Sequence CCTCACACCCGCTCTGGCTTACA CAAGGATGGAGTGAAATGCAGGG
Strand - +
Off-target summary No data {0: 6, 1: 51, 2: 27, 3: 42, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!