ID: 1061067150_1061067158

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1061067150 1061067158
Species Human (GRCh38) Human (GRCh38)
Location 9:128285668-128285690 9:128285710-128285732
Sequence CCCTCAGCTGTGGCCAGGGTCAC CAACCCCACCCTAAGGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 347} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!