ID: 1061094647_1061094661

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1061094647 1061094661
Species Human (GRCh38) Human (GRCh38)
Location 9:128448641-128448663 9:128448691-128448713
Sequence CCCGCCTCCACCTCCCAAAGTGC CCAGCTGCTCATTTGGATATAGG
Strand - +
Off-target summary {0: 667, 1: 6733, 2: 160784, 3: 254256, 4: 212729} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!