ID: 1061254431_1061254444

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1061254431 1061254444
Species Human (GRCh38) Human (GRCh38)
Location 9:129445985-129446007 9:129446033-129446055
Sequence CCAAGATCAAGGTGCCAGCAGGG CCTGGCTCGCCTGTGTCCTCAGG
Strand - +
Off-target summary {0: 39, 1: 381, 2: 1291, 3: 2716, 4: 4413} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!