ID: 1061282978_1061282988

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1061282978 1061282988
Species Human (GRCh38) Human (GRCh38)
Location 9:129608030-129608052 9:129608072-129608094
Sequence CCGTGAGGGCCCTCCTCCGGGTT CGGTATCCGCACAAGGAGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!