ID: 1061403592_1061403594

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1061403592 1061403594
Species Human (GRCh38) Human (GRCh38)
Location 9:130381850-130381872 9:130381867-130381889
Sequence CCAGCAACCACTGCTGTCACCCC CACCCCCAGCACTGCCATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 261} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!