ID: 1061436765_1061436769

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1061436765 1061436769
Species Human (GRCh38) Human (GRCh38)
Location 9:130568180-130568202 9:130568210-130568232
Sequence CCACCAGGGGCCTGGTAGTCAAG GAGTAGTAATTTAAGATAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 855} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!