ID: 1061450898_1061450912

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1061450898 1061450912
Species Human (GRCh38) Human (GRCh38)
Location 9:130666528-130666550 9:130666571-130666593
Sequence CCGGGGTCCCGGCGGGGAAGGAA CGGGCTCTGACCGGTTTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 164} {0: 1, 1: 0, 2: 2, 3: 4, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!