ID: 1061450903_1061450912

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1061450903 1061450912
Species Human (GRCh38) Human (GRCh38)
Location 9:130666536-130666558 9:130666571-130666593
Sequence CCGGCGGGGAAGGAAGGGCCGGG CGGGCTCTGACCGGTTTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 328} {0: 1, 1: 0, 2: 2, 3: 4, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!