ID: 1061584048_1061584056

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1061584048 1061584056
Species Human (GRCh38) Human (GRCh38)
Location 9:131554983-131555005 9:131555008-131555030
Sequence CCGCGCTCTTCTCGCCGCCCGCC GGCCGCCTTCCCCTTCCCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 242} {0: 1, 1: 0, 2: 0, 3: 35, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!