ID: 1061584048_1061584059

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1061584048 1061584059
Species Human (GRCh38) Human (GRCh38)
Location 9:131554983-131555005 9:131555015-131555037
Sequence CCGCGCTCTTCTCGCCGCCCGCC TTCCCCTTCCCCGTGGTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 242} {0: 1, 1: 0, 2: 1, 3: 15, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!