ID: 1061627137_1061627153

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1061627137 1061627153
Species Human (GRCh38) Human (GRCh38)
Location 9:131847473-131847495 9:131847526-131847548
Sequence CCTTGAACCAGGCAGAGGCTTCT GAGGGCTAGCTGAGGACCCACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!