ID: 1061726501_1061726511

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1061726501 1061726511
Species Human (GRCh38) Human (GRCh38)
Location 9:132584809-132584831 9:132584854-132584876
Sequence CCTGCTTAGAGAGGCAAAGAAAA ATGGAGAAGGGGGAGGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 77, 3: 789, 4: 4603}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!