ID: 1061747810_1061747819

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1061747810 1061747819
Species Human (GRCh38) Human (GRCh38)
Location 9:132753141-132753163 9:132753175-132753197
Sequence CCCAGGAGGAAGGAGCCAGGCCA CTTTTGTCCTGGGGAATCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 435} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!