ID: 1061747813_1061747819

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1061747813 1061747819
Species Human (GRCh38) Human (GRCh38)
Location 9:132753161-132753183 9:132753175-132753197
Sequence CCACTGTTGACCTCCTTTTGTCC CTTTTGTCCTGGGGAATCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 282} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!